Command Line Interface (CLI)

• CLI can be made quickly to try out an idea
• Parameters allow fleixble input and output
• CLI's can often handle larger volumes of data than GUI's
• A Help command can make them easy to use

  gccontent.py -h
  
  Help for gccontent
  -h    help
  -sSEQUENCE pass in a nucleic acid sequence string
  -fFASTA_FILE pass in a FATSA file name
  -x    Return the results as XML
  examples:
      gccontent.py -s acggattcaggcatttatcgatcg
      
      gccontent.py -f isolatedseqs.fasta
  

• Command line tools can be chained together quickly by a data analyst. If the idea works well a software developer can use the API to develop a higher throughput version.
• Example: another tool code calculate melting temperature and be tied to the output of gccontent.